Jump to content
InsanelyMac Forum
  • Announcements

    • Allan

      Solution to create a topic or post.   04/24/2018

      Hello guys. The majority of you are having issues to create a topic or post here. This are a problem with our current theme InsanelyMac.  Now the theme will be the Default IPS. Sorry for any inconvenience.
Meowpard

What in the DNA keeps a "house cat" from growing to the size of a big cat?

Recommended Posts

This part:

 

1 ACCGTTCGCAAGAAATGCGCAGAACAGCAAGTTCTATTTA…

61 GAACTTGCGTAACAGAATCAGTTGAGCTTAATGTCAGCCT…

121 CCTAGAGGATGTTGCTTGTCATGATACGCATGAATCGTCA…

181 GAATGAAGAGTCTCGTTGCCAGTATAAAAGACTCGTATTC…

241 AGTGCAGCTCACAGAACTCATCGTTATCCTGTTGATCAGA…

301 TTGGATCGAACTCGATTTCTGACTGGGTTGGAAGGCAAGA…

361 TTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGA…

421 TTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGG…

481 TAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTAC…

541 ATTGTTTGTGCACTTGCCGGCATGCCGGTAGAGGTGTGGT…

601 TATACCTGAGAAAGCAACCTGACCTACAGGAAAGAGTTAC…

661 TTTAAAACCTAAGAGTCACTTTAAAATTTGTATACACTTA…

721 ATAATAAAAATCATAAATCATAAGAAATTCGCCCGGAATT…

781 GATCCACCTTTCTGAGCCACTTCCGGTACTGGCACAGCCT…

841 GTGTCGGTAGCTTGTTTGTTTGAAGAAGGCCTTGAATTAG…

901 GTATCCAGATTGGTTACGGTAACAGATGGTAAGTTCAGGG…

961 TAGTTGCTGTTCTCAGCCTTCCCAGGAGTGATGGCACCTG…

1021 GGCACTCAGTTGGCTCACAGTTGGAGAGACAGCCTCCGTC…

1081 AAGGAATCACTGCTGCCTCTATTGGACTTGGAGCCACCCC…

1141 TCTCCCGCTTTCTCTTTCTTTGGGGAATGGCGATTATTTT…

1201 CTCTCAAACATCTTTCGAGTCTCTGTGAACTTAGCATACG…

1261 TCAAATCTGCTAATCCGT

 

found it on

 

http://answers.yahoo.com/question/index?qi...16112155AAwFdKL

 

 

me thought it was eleminating every CAT sequence in the code

Share this post


Link to post
Share on other sites
Advertisement

Create an account or sign in to comment

You need to be a member in order to leave a comment

Create an account

Sign up for a new account in our community. It's easy!

Register a new account

Sign in

Already have an account? Sign in here.

Sign In Now


  • Recently Browsing   0 members

    No registered users viewing this page.



×