Jump to content

What in the DNA keeps a "house cat" from growing to the size of a big cat?


  • Please log in to reply
No replies to this topic

#1
Meowpard

Meowpard

    InsanelyMac Geek

  • Members
  • PipPipPip
  • 150 posts
  • Gender:Male
  • Location:north of .de
This part:

1 ACCGTTCGCAAGAAATGCGCAGAACAGCAAGTTCTATTTA…
61 GAACTTGCGTAACAGAATCAGTTGAGCTTAATGTCAGCCT…
121 CCTAGAGGATGTTGCTTGTCATGATACGCATGAATCGTCA…
181 GAATGAAGAGTCTCGTTGCCAGTATAAAAGACTCGTATTC…
241 AGTGCAGCTCACAGAACTCATCGTTATCCTGTTGATCAGA…
301 TTGGATCGAACTCGATTTCTGACTGGGTTGGAAGGCAAGA…
361 TTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGA…
421 TTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGG…
481 TAGCAAATTTCGTCAAAAATGCTAAGAAATAGGTTATTAC…
541 ATTGTTTGTGCACTTGCCGGCATGCCGGTAGAGGTGTGGT…
601 TATACCTGAGAAAGCAACCTGACCTACAGGAAAGAGTTAC…
661 TTTAAAACCTAAGAGTCACTTTAAAATTTGTATACACTTA…
721 ATAATAAAAATCATAAATCATAAGAAATTCGCCCGGAATT…
781 GATCCACCTTTCTGAGCCACTTCCGGTACTGGCACAGCCT…
841 GTGTCGGTAGCTTGTTTGTTTGAAGAAGGCCTTGAATTAG…
901 GTATCCAGATTGGTTACGGTAACAGATGGTAAGTTCAGGG…
961 TAGTTGCTGTTCTCAGCCTTCCCAGGAGTGATGGCACCTG…
1021 GGCACTCAGTTGGCTCACAGTTGGAGAGACAGCCTCCGTC…
1081 AAGGAATCACTGCTGCCTCTATTGGACTTGGAGCCACCCC…
1141 TCTCCCGCTTTCTCTTTCTTTGGGGAATGGCGATTATTTT…
1201 CTCTCAAACATCTTTCGAGTCTCTGTGAACTTAGCATACG…
1261 TCAAATCTGCTAATCCGT

found it on

http://answers.yahoo...16112155AAwFdKL


me thought it was eleminating every CAT sequence in the code





0 user(s) are reading this topic

0 members, 0 guests, 0 anonymous users

© 2014 InsanelyMac  |   News  |   Forum  |   Downloads  |   OSx86 Wiki  |   Mac Netbook  |   PHP hosting by CatN  |   Designed by Ed Gain  |   Logo by irfan  |   Privacy Policy